Antithrombin deficiency caused by SERPINC1 gene mutation in white matter lesions: A case report.

RATIONALE: White matter lesions (WMLs) are structural changes in the brain that manifest as demyelination in the central nervous system pathologically. Vasogenic WMLs are the most prevalent type, primarily associated with advanced age and cerebrovascular risk factors. Conversely, immunogenic WMLs, typified by multiple sclerosis (MS), are more frequently observed in younger patients. It is crucial to distinguish between these 2 etiologies. Furthermore, in cases where multiple individuals exhibit WMLs within 1 family, genetic testing may offer a significant diagnostic perspective. PATIENT CONCERNS: A 25-year-old male presented to the Department of Neurology with recurrent headaches. He was healthy previously and the neurological examination was negative. Brain magnetic resonance imaging (MRI) showed widespread white matter hyperintensity lesions surrounding the ventricles and subcortical regions on T2-weighted and T2 fluid-attenuated inversion recovery images, mimicking immunogenic disease-MS. DIAGNOSES: The patient was diagnosed with a patent foramen ovale, which could explain his headache syndrome. Genetic testing unveiled a previously unidentified missense mutation in the SERPINC1 gene in the patient and his father. The specific abnormal laboratory finding was a reduction in antithrombin III activity, and the decrease may serve as the underlying cause for the presence of multiple intracranial WMLs observed in both the patient and his father. INTERVENTIONS: The patient received percutaneous patent foramen ovale closure surgery and took antiplatelet drug recommended by cardiologists and was followed up for 1 month and 6 months after operation. OUTCOMES: While the lesions on MRI remain unchanging during follow-up, the patient reported a significant relief in headaches compared to the initial presentation. LESSONS: This case introduces a novel perspective on the etiology of cerebral WMLs, suggesting that hereditary antithrombin deficiency (ATD) could contribute to altered blood composition and may serve as an underlying cause in certain individuals with asymptomatic WMLs.

Pulmonary thromboembolism associated with hereditary antithrombin III deficiency: A case report.

BACKGROUND: Thrombophilia is a coagulation disorder closely associated with venous thromboembolism. Hereditary antithrombin III (AT III) deficiency is a type of genetic thrombophilia. In China, genetic thrombophilia patients mainly suffer from deficiencies in AT III, protein S, and protein C. Multiple mutations in the serpin family C member 1 (SERPINC1) can affect AT III activity, resulting in thrombosis. CASE PRESENTATION: This case presented a 17-year-old adolescent female who developed lower extremity venous thrombosis and subsequently pulmonary embolism (PE) following a right leg injury. A missense mutation in gene SERPINC1 of c.331 T > C, p.S111P was detected on the patient, resulting in a decreased AT III activity and an elevated risk of thrombosis. The patient received anticoagulation treatment for approximately 5 months. During follow-up, the blood clot gradually dissolved, and there have been no recurrent thrombotic events reported thus far. DISCUSSION: Hereditary AT deficiency can be classified into two types based on the plasma levels of the enzymatic activity and antigen. Type I is a quantitative defect, while Type II is a qualitive defect. Until 2021, 486 SERPINC1 gene mutations have been registered, more than 18% of which are point mutations. The SERPINC1 mutation c.331 T > C in was firstly reported in 2017, which was classified into type I AT III deficiency. CONCLUSION: Hereditary thrombophilia is a coagulation disorder with a high omission diagnostic rate. Minor mutations in the SERPINC1 gene can also lead to hereditary AT III deficiency, which in turn can cause PE. We emphasized the importance of etiological screening for hereditary thrombophilia in venous thromboembolism patients without obvious high-risk factors. Long-term anticoagulation treatment and avoidance of potential thrombosis risk factors are critical for such patients.

Clinical and Molecular Characterization of Nine Novel Antithrombin Mutations.

Antithrombin (AT) is the major plasma inhibitor of thrombin (FIIa) and activated factor X (FXa), and antithrombin deficiency (ATD) is one of the most severe thrombophilic disorders. In this study, we identified nine novel AT mutations and investigated their genotype-phenotype correlations. Clinical and laboratory data from patients were collected, and the nine mutant AT proteins (p.Arg14Lys, p.Cys32Tyr, p.Arg78Gly, p.Met121Arg, p.Leu245Pro, p.Leu270Argfs*14, p.Asn450Ile, p.Gly456delins_Ala_Thr and p.Pro461Thr) were expressed in HEK293 cells; then, Western blotting, N-Glycosidase F digestion, and ELISA were used to detect wild-type and mutant AT. RT-qPCR was performed to determine the expression of AT mRNA from the transfected cells. Functional studies (AT activity in the presence and in the absence of heparin and heparin-binding studies with the surface plasmon resonance method) were carried out. Mutations were also investigated by in silico methods. Type I ATD caused by altered protein synthesis (p.Cys32Tyr, p.Leu270Argfs*14, p.Asn450Ile) or secretion disorder (p.Met121Arg, p.Leu245Pro, p.Gly456delins_Ala_Thr) was proved in six mutants, while type II heparin-binding-site ATD (p.Arg78Gly) and pleiotropic-effect ATD (p.Pro461Thr) were suggested in two mutants. Finally, the pathogenic role of p.Arg14Lys was equivocal. We provided evidence to understand the pathogenic nature of novel SERPINC1 mutations through in vitro expression studies.

[Phenotypic and genetic analysis of a Chinese pedigree affected with Hereditary antithrombin deficiency due to a novel variant of SERPINC1 gene].

OBJECTIVE: To analyze the clinical phenotype and genetic characteristics of a Chinese pedigree affected with Hereditary antithrombin deficiency. METHODS: A pedigree diagnosed at the the Second Affiliated Hospital of Wenzhou Medical University, Yuying Children's Hospital in June, 2020 was selected as the study subject. Plasma prothrombin time (PT), activated partial thromboplastin time (APTT), fibrinogen (FIB), and thrombin time (TT) of the probands and their pedigree members were determined using a STA-R automatic coagulation analyzer. Antithrombin activity (AT: A) and antithrombin antigen (AT: Ag) in plasma were determined with chromogenic substrate and immunonephelometry assays. All exons and flanking sequences of the anticoagulant protein gene SERPINC1 were amplified by PCR and subjected to Sanger sequencing. Candidate variants were verified with bioinformatic tools (PolyPhen-2, SIFT, Mutation Taster and PYMOL) to explore their effect on the function and structural conformation of the protein. RESULTS: The probands (II-2, II-10), their brother (II-5) and sons (III-1, III-8) had shown normal PT, APTT, FIB, and TT, but significantly decreased AT: A and AT: Ag, with their levels being 34%, 57%, 56%, 48%, 53% and 13.51 mg/dL, 13.44 mg/dL, 18.39 mg/dL, 17.36 mg/dL, 17.71 mg/dL, respectively. The remaining pedigree members had normal values. Sanger sequencing revealed that the probands and all affected pedigree members had harbored a heterozygous c.851T>C (p.Met284Thr) missense variant in exon 5 of the SERPINC1 gene. Bioinformatic analysis and simulation suggested that the variant has resulted in alteration of hydrogen bonds at the c.851 position, which may affect the structure of the protein. Based on the guidelines from the American College of Medical Genetics and Genomics (ACMG), the variant was classified as pathogenic (PS1+PM1+PM5+PP1+PP4). CONCLUSION: The probands and other affected members were all diagnosed with type I hereditary AT deficiency, for which the c.851T>C (p.Met284Thr) variant of the SERPINC1 gene may be accountable.

Clinical and functional characterization of rare compound heterozygous mutations in the SERPINC1 gene causing severe thrombophilia.

INTRODUCTION: Hereditary antithrombin (AT) deficiency is a rare autosomal dominant disorder with significant clinical heterogeneity. In the study, we identified a patient with AT deficiency caused by compound heterozygous mutations in the SERPINC1 gene. METHODS: A total of 9 individuals from three generations were investigated. The mutations were identified by direct sequencing of SERPINC1. Multiple in silico tools were programmed to predict the conservation of mutations and the effect on the AT structure. The coagulation state was evaluated by the thrombin generation assay. Recombinant AT was overexpressed in HEK293T cells; the mRNA level was determined using RT-qPCR. Western blotting, ELISA, and immunocytofluorescence were applied to characterize the recombinant AT protein. RESULTS: The proband was a 26-year-old male who experienced recurrent venous thrombosis. He presented the type I deficiency with 33 % AT activity and a synchronized decrease in AT antigen. Genetic screening revealed that he carried a heterozygous c.318_319insT (p.Asn107*) in exon 2 and a heterozygous c.922G > T (p.Gly308Cys) in exon 5, both of which were completely conserved in homologous species and resulted in enhanced thrombin generation capability. Hydrophobicity analysis suggested that the p.Gly308Cys mutation may interfere with the hydrophobic state of residues 307-313. In vitro expression studies indicated that the levels of the recombinant protein AT-G308C decreased to 46.98 % ± 2.94 % and 41.35 % ± 1.48 % in transfected cell lysates and media, respectively. After treatment with a proteasome inhibitor (MG132), the quantity of AT-G308C protein in the cytoplasm was replenished to a level comparable to that of the wild type. The mRNA level of AT-N107* was significantly reduced and the recombinant protein AT-N107* was not detected in either the lysate or the culture media. CONCLUSION: These two mutations were responsible for the AT defects and clinical phenotypes of the proband. The p.Gly308Cys mutation could lead to proteasome-dependent degradation of the AT protein in the cytoplasm by altering local residue hydrophobicity. The c.318_319insT could eliminate aberrant transcripts by triggering nonsense-mediated mRNA degradation. Both mutations resulted in type I AT deficiency.

Hereditary Antithrombin Deficiency Presenting with Cerebral Venous Thrombosis in Three Members of a Family.

Hereditary antithrombin (AT) deficiency is a rare thrombophilia associated with cerebral vein thrombosis (CVT). We report a case study of hereditary AT deficiency causing CVT in three members of a family. A 29-year-old female presented with features of CVT. Her mother and a sister had CVT in the past and investigation for hereditary thrombophilia revealed low blood AT activity in all of them. The index patient (proband) was positive for the SERPINC1 gene mutation confirming the diagnosis of hereditary AT deficiency. She recovered well with anticoagulation and was advised to continue it lifelong. Diagnosing hereditary thrombophilia like AT deficiency is important in planning anticoagulation and proper counseling of asymptomatic family members regarding prophylaxis for venous thromboembolism (VTE) in high-risk situations.

Comparison of antithrombin activity assays in detection of patients with heparin binding site antithrombin deficiency: systematic review and meta-analysis.

Antithrombin (AT) deficiency increases the risk for venous thromboembolism, therefore, a highly sensitive assay to identify this condition is crucial. The aim of this paper was to perform a meta-analysis comparing AT activities measured by different AT activity assays in patients with heparin binding site AT deficiency. In addition, the diagnostic sensitivity of selected assays was compared depending on the available data. An extensive literature search was performed considering results with publication date up to July 10, 2021. Seven relevant English-language observational studies, comparing AT activity measured by different AT activity assays in Caucasian Europeans with either the AT Budapest III or AT Padua I mutation were included in meta-analyses. There was no significant difference in AT activity between Labexpert and Innovance in patients with AT Budapest III (P = 0.567) and AT Padua I (P = 0.265), while AT activity determined by HemosIL was significantly higher compared to Innovance for both mutations (AT Budapest III: P < 0.001; AT Padua I: P < 0.001). These results are in line with the results of comparison of diagnostic sensitivity. In patients with AT Budapest III, the AT activity was also higher when measured with Berichrom compared to Innovance (P = 0.002), however, the results of comparison of diagnostic sensitivity across studies were variable. No significant difference (P = 0.117) in AT activity as well as diagnostic sensitivity was observed between Sta-Stachrom and Innovance. The results of our study suggest that Innovance, Labexpert and Sta-Stachrom are the most sensitive activity assays for detection of AT Budapest III and AT Padua I, whereas HemosIL showed considerably lower sensitivity for these two variants. As revealed in our study, the diagnostic sensitivity of AT activity assays to type II heparin binding site AT deficiency is different, and in some assays mutation dependent.

Thrombin Generation Decrease After LMWH Administration in an Antithrombin-Deficient Pregnant Woman With a Homozygous HBS II Mutation.

The cases of antithrombin (AT)-deficient pregnant women with a homozygous HBS II mutation are relatively rare and are accompanied by an increased thrombophilic risk, which is manifested by increased thrombin generation (TG). It is very difficult to ensure their prophylactic treatment during pregnancy. We aimed to determine the utility of the thrombin generation assay (TGA) and anti-factor Xa (anti-FXa) test to monitor the effects of a prophylactic dose of low-molecular-weight heparin (LMWH) in a 28-year-old woman with homozygous AT deficiency caused by mutation c.391C > T#, (p.Leu131Phe†) in the SERPINC1 gene and to compare the findings with those from a group of pregnant and non-pregnant women also treated with LMWH. TG monitoring was chosen due to severe AT deficiency that was manifested by low levels of anti-FXa activity when monitoring the efficacy of LMWH treatment. A significant decrease in TG was detected in all monitored groups (P < .05). There were no thrombotic complications during the whole pregnancy of the woman with AT deficiency. Consistent monitoring of TG with LMWH anticoagulant therapy administration during pregnancy together with AT administration before and after delivery may improve the overall condition of pregnant women and the quality of their care.

Functional analysis of two abnormal antithrombin proteins with different intracellular kinetics.

INTRODUCTION: Hereditary antithrombin (AT) deficiency type I causes venous thrombosis due to decreased levels of AT antigen in the blood. We identified one novel and one known abnormal variant in two unrelated Japanese families with venous thrombosis. In this study, we analyzed the mechanism by which these abnormal variants cause type I AT deficiency. MATERIALS AND METHODS: Wild-type and variant AT expression vectors were constructed and transiently expressed in human embryonic kidney 293 cells, and AT antigen levels and N-glycosylation of cell lysates and culture medium were evaluated by western blot analysis. Subcellular co-localization of AT was also examined using confocal microscopy, and chase experiments with cycloheximide and MG132 were performed to investigate the degradation pathway of AT variants. RESULTS: Genetic analysis identified a novel variant, c.613delC (p.Leu205Trpfs⁎79), and the known variant c.283T>C (p.Tyr95His). These AT variants exhibited significantly reduced extracellular secretion compared with the wild-type; N-glycosylation of the AT protein was normal. Co-localization analysis suggested that the transport of these abnormal AT proteins to the Golgi apparatus was impaired. The c.613delC variant was degraded early by the proteasome, suggesting that the c.283T>C variant is stored in the endoplasmic reticulum (ER). CONCLUSIONS: The AT variants identified here synthesize abnormal AT proteins that exhibit suppressed secretion and impaired transport from the ER to the Golgi apparatus. These results provide clues that could help elucidate the mechanism of type I AT deficiency and facilitate therapy development.

Impact of SERPINC1 mutation on thrombotic phenotype in children with congenital antithrombin deficiency-first analysis of the International Society on Thrombosis and Haemostasis pediatric antithrombin deficiency database and biorepository.

BACKGROUND: The natural history and genotype-phenotype correlation of congenital antithrombin (AT) deficiency in children are unknown. OBJECTIVES: To describe the clinical presentation of congenital AT deficiency in children and evaluate its correlation to specific mutations in SERPINC1. METHODS: In 2017, a prospective pediatric database and DNA biorepository for congenital AT deficiency was established. During the pilot phase, the database was opened at 4 tertiary care centers in Canada and US. Approval from research ethics board was obtained at each participating center. Written consent/assent was obtained from guardians/subjects who met eligibility. Demographic/clinical data were uploaded into a database. DNA extraction and SERPINC1 sequencing were centralized for US centers. Standard statistical methods were used to summarize parameters. Probability of VTE-free survival was assessed using the Kaplan-Meier method. RESULTS: Overall, 43 participants (25 females) from 31 unique kindreds were enrolled. Median age (range) at enrollment was 14.8 years (1-21 years). Median AT activity was 52% (24%-87%), and median AT antigen (n = 20) was 55% (38%-110%). Nineteen (44%) participants had a history of venous thromboembolism (VTE). Median age at VTE diagnosis was 12.8 years (0.1-19.2 years). SERPINC1 sequencing was completed for 31 participants and 21 unique mutations were identified, including 5 novel variants. Probability of 5-year VTE-free survival (95% CI) for carriers of missense mutations (92.0% [95% CI: 71.6%-97.9%]) was significantly higher compared with carriers of null mutations (66.7% [95% CI: 19.5%-90.4%]); p = .0012. CONCLUSION: To our knowledge, this is the first pediatric study to document a severe thrombotic phenotype in carriers of null mutations in SERPINC1, when compared with carriers of missense mutations; underscoring the importance of genetic testing.

Identification and functional analysis of three novel genetic variants resulting in premature termination codons in three unrelated patients with hereditary antithrombin deficiency.

Hereditary antithrombin (AT) deficiency is an autosomal dominant inherited thrombophilia. In three pedigrees of hereditary type I AT deficiency, we identified novel variants c.126delC (p.Lys43Serfs*7), c.165C > G (p.Tyr55*), and c.546delA (p.Lys182Asnfs*102) in the open reading frame encoding AT in each patient. Each of these aberrant variants leads to premature termination of AT protein synthesis. To investigate whether these abnormal variants are involved in the pathogenesis of type I AT deficiency, we analyzed the function of these variants in HEK293 cells. Results of western blot analysis and immunofluorescence microscopy showed that all abnormal variants were expressed intracellularly, but p.Lys43Serfs*7 and p.Tyr55* protein were aggregated in the cells. These three variants were not detected in the spent culture medium, indicating that these novel variants affect protein secretion. In summary, we suggest that these variants in the AT-encoding gene are translated in the cell, but form abnormal proteins that form aggregates and/or inhibit secretion. These results provide insight into novel mechanisms of type I AT deficiency and potential therapies for the condition.

Fatal Cerebral Venous Thrombosis in a Pregnant Woman with Inherited Antithrombin Deficiency after BNT162b2 mRNA COVID-19 Vaccination.

Antithrombin deficiency is a high-risk factor for venous thromboembolism during pregnancy, whereas cerebral venous thrombosis is rare. Cerebral venous thrombosis related to coronavirus disease 2019 (COVID-19) vaccines has been reported; however, there are a few reports of cerebral venous thrombosis after a messenger RNA (mRNA) vaccination. A 25-year-old female in her sixth week of pregnancy presented with headache 24 days after BNT162b2 mRNA COVID-19 vaccination. The following day, she presented with altered sensorium and was diagnosed with severe cerebral venous thrombosis. She demonstrated heparin resistance and was found to have an inherited antithrombin deficiency. A heterozygous missense variant in SERPINC1 (c.379T>C, p.Cys127Arg, 'AT Morioka') was detected by DNA analysis. Despite intensive care with unfractionated heparin, antithrombin concentrate, and repeated endovascular treatments, she died on the sixth day of hospitalization. Cerebral venous thrombosis in pregnant women with an antithrombin deficiency can follow a rapid and fatal course. Treatment with unfractionated heparin and antithrombin concentrate may be ineffective in severe cerebral venous thrombosis cases with antithrombin deficiency. Early recognition of antithrombin deficiency and an immediate switch to other anticoagulants may be required. Although the association between cerebral venous thrombosis and the vaccine is uncertain, COVID-19 vaccinations may require careful evaluation for patients with prothrombic factors.

Inherited antithrombin deficiency caused by a mutation in the SERPINC1 gene: A case report.

RATIONALE: Inherited antithrombin deficiency (ATD) is a major cause of thrombotic deficiency. Genetic testing is of great value in the diagnosis of hereditary thrombophilia. Herein, we report a case of inherited ATD admitted to our hospital. We include the results of genealogy and discuss the significance of genetic testing in high-risk groups of hereditary thrombophilia. PATIENT CONCERNS: A 16-year-old male patient presented with chest tightness, shortness of breath, wheezing, and intermittent fever (up to 39 °C) after strenuous exercise for 2 weeks. He also had a cough with white sputum with a small amount of bright red blood in the sputum and occasional back pain. DIAGNOSES: The blood tests showed that the patient's antithrombin III concentration and activity were both significantly reduced to 41% and 43.2%, respectively. Enhanced chest computed tomography scans showed pulmonary infarction in the lower lobe of the right lung with multiple embolisms in the bilateral pulmonary arteries and branches. Lower vein angiography revealed a contrast-filling defect of the inferior vena cava and left common iliac vein. Thrombosis was considered as a differential diagnosis. His father and his uncle also had a history of thrombosis. The patient was diagnosed with inherited ATD. Further, peripheral venous blood samples of the family members were collected for whole-exome gene sequencing, and Sanger sequencing was used to verify the gene mutation site in the family. The patient and his father had a SERPINC1 gene duplication mutation: c.1315_1345dupCCTTTCCTGGTTTTTAAGAGAAGTTCCTC (NM000488.4). INTERVENTIONS: An inferior vena cava filter was inserted to avoid thrombus shedding from the lower limbs. Urokinase was injected intermittently through the femoral vein cannula for thrombolysis. Heparin combined with warfarin anticoagulant therapy was sequentially administered. After reaching the international normalized ratio, heparin was discontinued, and oral warfarin anticoagulant therapy was continued. After discharge, the patient was switched to rivaroxaban as oral anticoagulation therapy. OUTCOMES: The patient's clinical symptoms disappeared. reexamination showed that the thrombotic load was less than before, and the inferior vena cava filter was then removed. LESSONS: By this report we highlight that gene detection and phenotypic analysis are important means to study inherited ATD.

Analysis of phenotype and gene mutation in three pedigrees with inherited antithrombin deficiency.

BACKGROUND: Inherited AT deficiency is an autosomal-dominant thrombophilic disorder usually caused by various SERPINC1 defects associated with a high risk of recurrent venous thromboembolism. In this article, the phenotype, gene mutation, and molecular pathogenic mechanisms were determined in three pedigrees with inherited AT deficiency. METHODS: Coagulation indices were examined on STAGO STA-R-MAX analyzer. The AT:Ag was analyzed by ELISA. All exons and flanking sequences of SERPINC1 were amplified by PCR. AT wild type and three mutant expression plasmids were constructed and then transfected into HEK293FT cells. The expression level of AT protein was analyzed by ELISA and Western blot. RESULTS: The AT:A and AT:Ag of probands 1 and 3 were decreased to 49% and 52 mg/dL, 38% and 44 mg/dL, respectively. The AT:A of proband 2 was decreased to 32%. The SERPINC1 gene analysis indicated that there was a p.Ile421Thr in proband 1, a p.Leu417Gln in proband 2, and a p.Met252Thr in proband 3, respectively. The AT mRNA expression level of the three mutants was not significantly different from AT-WT by qRT-PCR. The results of ELISA and Western blot tests showed that the AT-M252T and AT-I421T mutants had a higher AT expression than the AT wild type (AT-WT), and the AT protein expression of AT-L417Q mutants had no significant difference compared with AT-WT in the cell lysate. The AT expression levels of AT-M252T and AT-I421T mutants were lower than that of AT-WT, and there was no significant difference between AT-L417Q mutant and AT-WT in the supernatant. CONCLUSION: The p.I421T and p.M252T mutations affected the secretion of AT protein leading to type I AT deficiency of probands 1 and 3. The p.Leu417Gln mutation was responsible for the impaired or ineffective activity AT protein in proband 2 and caused type II AT deficiency.

Long-Read Sequencing Identifies the First Retrotransposon Insertion and Resolves Structural Variants Causing Antithrombin Deficiency.

The identification of inherited antithrombin deficiency (ATD) is critical to prevent potentially life-threatening thrombotic events. Causal variants in SERPINC1 are identified for up to 70% of cases, the majority being single-nucleotide variants and indels. The detection and characterization of structural variants (SVs) in ATD remain challenging due to the high number of repetitive elements in SERPINC1. Here, we performed long-read whole-genome sequencing on 10 familial and 9 singleton cases with type I ATD proven by functional and antigen assays, who were selected from a cohort of 340 patients with this rare disorder because genetic analyses were either negative, ambiguous, or not fully characterized. We developed an analysis workflow to identify disease-associated SVs. This approach resolved, independently of its size or type, all eight SVs detected by multiple ligation-dependent probe amplification, and identified for the first time a complex rearrangement previously misclassified as a deletion. Remarkably, we identified the mechanism explaining ATD in 2 out of 11 cases with previous unknown defect: the insertion of a novel 2.4 kb SINE-VNTR-Alu retroelement, which was characterized by de novo assembly and verified by specific polymerase chain reaction amplification and sequencing in the probands and affected relatives. The nucleotide-level resolution achieved for all SVs allowed breakpoint analysis, which revealed repetitive elements and microhomologies supporting a common replication-based mechanism for all the SVs. Our study underscores the utility of long-read sequencing technology as a complementary method to identify, characterize, and unveil the molecular mechanism of disease-causing SVs involved in ATD, and enlarges the catalogue of genetic disorders caused by retrotransposon insertions.

Peripartum management of hereditary thrombophilia: results of primary surveillance in Japan.

This study investigated patients with thrombophilia and current peripartum management practices based on national surveillance in Japan. Between 2014 and 2018, antithrombin (AT), protein C (PC) and protein S (PS) deficiency were observed in 84, 67, and 443 pregnancies, respectively, with incidence rates among total deliveries at 0.012%, 0.009%, and 0.061%. The percentage of institutions that measured both antigens and AT, PC, and PS activity for the diagnosis of thrombophilia was 50.2%, and 46.9% of institutions did not perform gene analysis. Prophylactic anticoagulation therapy was used in the ante- and postpartum management of patients with AT deficiency at 67.1% and 66.3% of institutions, most commonly with 10,000 units of unfractionated heparin. Ante- and postpartum management of PC and PS deficiency was performed at 75.3% and 67.1% of institutions. Approximately half of the institutions performed peripartum prophylactic AT supplementation for AT deficiency. Low trough AT activity before supplementation was most commonly 50 ≤ < 70%, and the highest AT supplementation was 1500 ≤ < 3000 units. The number of pregnancies with AT, PC and PS deficiency might be as many as 29, 23 and 151 every year in Japan if complete answers were provided.